Binding the mammalian high mobility group protein AT-hook 2 to AT-rich deoxyoligonucleotides: Enthalpy-entropy compensation Article

Joynt, S, Morillo, V, Leng, F. (2009). Binding the mammalian high mobility group protein AT-hook 2 to AT-rich deoxyoligonucleotides: Enthalpy-entropy compensation . Biophysical Journal, 96(10), 4144-4152. 10.1016/j.bpj.2009.02.015

cited authors

  • Joynt, S; Morillo, V; Leng, F

abstract

  • HMGA2 is a DNA minor-groove binding protein. We previously demonstrated that HMGA2 binds to AT-rich DNA with very high binding affinity where the binding of HMGA2 to poly(dA-dT)2 is enthalpy-driven and to poly(dA)poly(dT) is entropy-driven. This is a typical example of enthalpy-entropy compensation. To further study enthalpy-entropy compensation of HMGA2, we used isothermal-titration-calorimetry to examine the interactions of HMGA2 with two AT-rich DNA hairpins: 5′-CCAAAAAAAA AAAAAAAGCCCCCGCTTTTTTTTTTTTTTTGG-3′ (FL-AT-1) and 5′- CCATATATATATATATAGCCCCCGCTATATATATATAT ATGG-3′ (FL-AT-2). Surprisingly, we observed an atypical isothermal-titration-calorimetry-binding curve at low-salt aqueous solutions whereby the apparent binding-enthalpy decreased dramatically as the titration approached the end. This unusual behavior can be attributed to the DNA-annealing coupled to the ligand DNA-binding and is eliminated by increasing the salt concentration to ~200 mM. At this condition, HMGA2 binding to FL-AT-1 is entropy-driven and to FL-AT-2 is enthalpy-driven. Interestingly, the DNA-binding free energies for HMGA2 binding to both hairpins are almost temperature independent; however, the enthalpy-entropy changes are dependent on temperature, which is another aspect of enthalpy-entropy compensation. The heat capacity change for HMGA2 binding to FL-AT-1 and FL-AT-2 are almost identical, indicating that the solvent displacement and charge-charge interaction in the coupled folding/binding processes for both binding reactions are similar. © 2009 by the Biophysical Society.

authors

publication date

  • January 1, 2009

published in

Digital Object Identifier (DOI)

start page

  • 4144

end page

  • 4152

volume

  • 96

issue

  • 10